Issue 3870: typedef sequence<Interval> IntervalList; is missing from the spec IntervalList get_gaps(in AlignmentElement element, in Interval the_interval (biomolecular-ftf) Source: (Mr. Philip Lijnzaad, p.lijnzaad@med.uu.nl) Nature: Uncategorized Issue Severity: Summary: typedef sequence<Interval> IntervalList; is missing from the spec. First sub issue of issue # 3687 Resolution: Rejected. No change. CompositeSeqRegion already has this behavior. Revised Text: Actions taken: September 19, 2000: received issue May 24, 2001: closed issue Discussion: End of Annotations:===== Date: Tue, 19 Sep 2000 12:41:18 +0100 (BST) Message-Id: <200009191141.e8JBfIQ43369@o2-3.ebi.ac.uk> X-Authentication-Warning: o2-3.ebi.ac.uk: lijnzaad set sender to lijnzaad@ebi.ac.uk using -f From: Philip Lijnzaad To: biomolecular-ftf@omg.org cc: senger@ebi.ac.uk, muilu@ebi.ac.uk Subject: Issue 3687a (or whatever number): adding IntervalList Reply-to: lijnzaad@ebi.ac.uk Content-Type: text X-UIDL: /('e9HN IntervalList to DsLSRBioObjects.idl Philip -- When C++ is your hammer, everything looks like a thumb. (Steven Haflich) ----------------------------------------------------------------------------- Philip Lijnzaad, lijnzaad@ebi.ac.uk \ European Bioinformatics Institute,rm A2-24 +44 (0)1223 49 4639 / Wellcome Trust Genome Campus, Hinxton +44 (0)1223 49 4468 (fax) \ Cambridgeshire CB10 1SD, GREAT BRITAIN PGP fingerprint: E1 03 BF 80 94 61 B6 FC 50 3D 1F 64 40 75 FB 53 Date: Tue, 19 Sep 2000 12:51:27 +0100 (BST) Message-Id: <200009191151.e8JBpR437450@o2-3.ebi.ac.uk> X-Authentication-Warning: o2-3.ebi.ac.uk: lijnzaad set sender to lijnzaad@ebi.ac.uk using -f From: Philip Lijnzaad To: juergen@omg.org cc: biomolecular-ftf@omg.org, senger@ebi.ac.uk, muilu@ebi.ac.uk Subject: Re: split into new issues: Reply-to: lijnzaad@ebi.ac.uk Content-Type: text X-UIDL: j^Ce9ppTd9'9id9-B[d9 Dear Juergen, I made mistake: there's another sub-issue: > could you please, for the biomolecular-ftf, split issue 3687 into two new > issues: > > 3687a: > > typedef sequence IntervalList; is missing from the spec; can this > be added? > > ------------------------------------------------------------------------ > 3687b: > > add an operation > > IntervalList get_gaps(in AlignmentElement element, in Interval the_interval); > > to the interface Alignment. It's job is to simply return all the gaps of a > particular sequence in a particular alignment. For symmetry with > get_seq_region(), the_interval is also given, thus limiting the gaps to those > that you're interested in. > > ------------------------------------------------------------------------ I forgot a third sub-issue: 3687c: Separate the Alignment interface into more managable pieces as follows: interface SimpleAlignment : CosLifeCycle::LifeCycleObject { // ... // here, everything BUT get_seq_region() // ... } interface Alignment : SimpleAlignment { SeqRegion get_seq_region( in AlignmentElement element, in Interval the_interval) raises(ElementNotInAlignment, IntervalOutOfBounds); } ------------------------------------------------------------------------ with apologies, Philip -- When C++ is your hammer, everything looks like a thumb. (Steven Haflich) ----------------------------------------------------------------------------- Philip Lijnzaad, lijnzaad@ebi.ac.uk \ European Bioinformatics Institute,rm A2-24 +44 (0)1223 49 4639 / Wellcome Trust Genome Campus, Hinxton +44 (0)1223 49 4468 (fax) \ Cambridgeshire CB10 1SD, GREAT BRITAIN PGP fingerprint: E1 03 BF 80 94 61 B6 FC 50 3D 1F 64 40 75 FB 53 Date: Tue, 19 Sep 2000 14:50:41 -0700 From: Scott Markel Organization: NetGenics, Inc. X-Mailer: Mozilla 4.73 [en] (WinNT; U) X-Accept-Language: en MIME-Version: 1.0 To: lijnzaad@ebi.ac.uk CC: biomolecular-ftf@omg.org, senger@ebi.ac.uk, muilu@ebi.ac.uk Subject: Re: Issue 3687a (or whatever number): adding IntervalList References: <200009191141.e8JBfIQ43369@o2-3.ebi.ac.uk> Content-Transfer-Encoding: 7bit Content-Type: text/plain; charset=us-ascii X-UIDL: S#Le9o!l!!(add9@D]d9 General comment here - I'm going to wait on replying on the new issues until there are new issue numbers. I don't want to get into a situation where we have two issue numbers used in email for the same thing. Juergen will have new numbers out in a day or two. Scott Philip Lijnzaad wrote: > > Dear all, > > The EBI proposes as a resolution to 3687a (first sub-issue of 3687), to add > > typedef sequence IntervalList > > to DsLSRBioObjects.idl -- Scott Markel, Ph.D. NetGenics, Inc. smarkel@netgenics.com 4350 Executive Drive Tel: 858 455 5223 Suite 260 FAX: 858 455 1388 San Diego, CA 92121 Date: Mon, 16 Oct 2000 22:36:51 -0700 From: Scott Markel Organization: NetGenics, Inc. X-Mailer: Mozilla 4.75 [en] (WinNT; U) X-Accept-Language: en MIME-Version: 1.0 To: BSA FTF Subject: Re: issues 3870 - 3872 Biomolecular FTF issues References: <4.2.0.58.20000928141053.00c6f410@emerald.omg.org> Content-Transfer-Encoding: 7bit Content-Type: text/plain; charset=us-ascii X-UIDL: Y~\d9Vb(!!,pMe9-"Ee9 Juergen Boldt wrote: > > This is issue # 3870 > > typedef sequence IntervalList; is missing from the spec This behavior is already contained in CompositeSeqRegion, which extends Interval. An Interval can already represent an array of Intervals. > -------------------------------- > > This is issue 3871 > > IntervalList get_gaps(in AlignmentElement element, in Interval the_interval > > add an operation > > > > IntervalList get_gaps(in AlignmentElement element, in Interval > the_interval); > > > > to the interface Alignment. It's job is to simply return all the gaps of a > > particular sequence in a particular alignment. For symmetry with > > get_seq_region(), the_interval is also given, thus limiting the gaps to > those > > that you're interested in. Since this issue was discussed many times during design and we know that the functionality is provided by repeated calls to get_seq_region(), I'd prefer not to make this change. Obviously nothing prevents a vendor from providing this additional method in an extension. > ------------------------------ > > This is issue # 3872 > > Separate the Alignment interface into more managable pieces > > Separate the Alignment interface into more managable pieces as > follows: > > interface SimpleAlignment : CosLifeCycle::LifeCycleObject { > // ... > // here, everything BUT get_seq_region() > // ... > } > > interface Alignment : SimpleAlignment { > SeqRegion get_seq_region( > in AlignmentElement element, > in Interval the_interval) > raises(ElementNotInAlignment, IntervalOutOfBounds); > } I'm against this. I don't see what's gained by splitting Alignment into two interfaces. In either case, one interface or two, an implementation of get_seq_region() is required. Scott -- Scott Markel, Ph.D. NetGenics, Inc. smarkel@netgenics.com 4350 Executive Drive Tel: 858 455 5223 Suite 260 FAX: 858 455 1388 San Diego, CA 92121 Date: Tue, 17 Oct 2000 16:16:08 -0700 From: Scott Markel Organization: NetGenics, Inc. X-Mailer: Mozilla 4.75 [en] (WinNT; U) X-Accept-Language: en MIME-Version: 1.0 To: BSA FTF Subject: [OMG-BSA] proposed resolutions #3 Content-Transfer-Encoding: 7bit Content-Type: text/plain; charset=us-ascii X-UIDL: ZGd!!Y64e9e!gd9$Z6!! Here's a third batch of proposed resolutions. Based on email traffic there seems to be a consensus on the proposals. In a few cases the consensus is 2 of 3. In most cases it's 2 of 2. I'm not reproducing the entire text of the individual issues. You can find that at http://cgi.omg.org/issues/biomolecular-ftf.html. This message is *not* a vote. I plan to send out a message kicking off a vote probably on Friday. The timing depends on the responses to this message. Scott ======================================================================== Issue 3870: typedef sequence IntervalList; is missing from the spec Proposed resolution: No change. CompositeSeqRegion already has this behavior. ------------------------------------------------------------------------ Issue 3871: IntervalList get_gaps(in AlignmentElement element, in Interval the_interval Proposed resolution: Add CompositeSeqRegion get_gaps(in string key, in Interval the_interval) raises(ElementNotInAlignment, IntervalOutOfBounds); to the Alignment interface (section 2.1.15, IDL change on p. 2-43 and method block on p. 2-46). Update the IDL in appendix C.1. The coordinates of a gap would be those of the original sequence; gaps of length 0 are not allowed. A start == 0 would be before the first nucleotide/aminoacid; a start = N is a gap between nucleotides/aminoacids N and N+1 (so start = sequence.length would be after the last). Date: Tue, 17 Oct 2000 15:27:12 -0700 From: Scott Markel Organization: NetGenics, Inc. X-Mailer: Mozilla 4.75 [en] (WinNT; U) X-Accept-Language: en MIME-Version: 1.0 To: lijnzaad@ebi.ac.uk CC: BSA FTF Subject: Re: get_gaps() [ was: Re: issues 3870 - 3872 Biomolecular FTF issues ] References: <4.2.0.58.20000928141053.00c6f410@emerald.omg.org> <39EBE573.D721F2BD@netgenics.com> <14828.35323.945505.510495@o2-3.ebi.ac.uk> Content-Transfer-Encoding: 7bit Content-Type: text/plain; charset=us-ascii X-UIDL: HGld90ZV!!Pl3e9'~9!! Philip, Philip Lijnzaad wrote: > > Dear all, > > this is just to clarify our experience and position, as we do feel strongly > about adding get_gaps() to the spec. I've noticed. :) > Consider the following alignment: > > 1 2 3 4 5 6 > 7 8 > 12345678901234567890123456789012345678901234567890123456789012345678901234567890 > ATTC-----------------------------------------------------------------GACGGCCCATG > ATTC---------------------------------------------------------------------------G > A--------------------------------------------------------------------GACGGCCCATG > TTTCTTGTGTCTCAAGGACAGAAGAGACTTCAGGTTCCCCCAGGAGATGGTAAAAGGGAGCCAGTTGCAGAAGGCCCATG Small aside: Please note that this particular example can be represented by 5 columns. > It will come as no surprise that EBI will vote in favour of adding a > get_gaps() method :-) I'll go along with adding get_gaps(), but not IntervalList or the proposed SimpleAlignment/Alignment split. Scott -- Scott Markel, Ph.D. NetGenics, Inc. smarkel@netgenics.com 4350 Executive Drive Tel: 858 455 5223 Suite 260 FAX: 858 455 1388 San Diego, CA 92121